欢迎参加全国医学论文写作研修班(精华班)
2010中国妇产科学术会议二轮通知
Chinese Medical Journal
Home | Current issue | Past issues | News Press | Information | Contact us | Submission
Own by Chinese Medical Association
 
IF in 2009: 0.952
Chinese Medical Journal, 2007, Vol. 120 No. 2 : 155-158
Original Article
·LogIn/LogOut
·Fulltext PDF(226K) Free
·Abstract download
TXT | XML
·Articles in CMJ by
SHE Qi-mei
ZHAO Jing
·Articles in PubMed by
SHE QM
ZHAO J
·Put into my bookshelf
·Email to Friend
·Email to author
·Visit:5399
·Download:2985
·Advanced Search
·Related Articles
·Change font size: Small font Middle font Big font
·Cannot read some characters
Effect of dexamethasone on peroxisome proliferator activated receptor-gamma mRNA expression in 3T3-L1 adipocytes with the human recombinant adiponectin
SHE Qi-mei, ZHAO Jing, WANG Xia-lian, ZHOU Chang-man, SHI Xian-zhong
SHE Qi-mei Department of Endocrinology, Shijingshan Hospital of Beijing, Beijing 100043, China; ZHAO Jing Department of Anatomy, Peking University Health Science Centre, Beijing 100083, China; WANG Xia-lian Department of Endocrinology, Shijingshan Hospital of Beijing, Beijing 100043, China; ZHOU Chang-man Department of Anatomy, Peking University Health Science Centre, Beijing 100083, China; SHI Xian-zhong Department of Anatomy, Peking University Health Science Centre, Beijing 100083, China

Correspondence to: SHI Xian-zhong  Department of Anatomy, Peking University Health Science Centre, Beijing 100083, China  (Tel:86-10-82801466 Fax:86-10-82802877 Email:shixianzhong2008@yahoo.com.cn )
Keywords: adiponectin·transfection·3T3-L1 adipocytes·peroxisome proliferator activated receptor-gamma·dexamethasone
Abstract:

Background  The fat derived protein adiponectin plays an important role in the regulation of glucose metabolism. The aim of this study was to provide the experimental basis for further investigating on adiponectin (ADPN) function. Its eukaryotic recombinant was constructed and expressed in precursor cells of 3T3-L1 adipocytes. The effects of dexamethasone on peroxisome proliferator activated receptor-gamma (PPAR-γ) mRNA expression in 3T3-L1 cells with human recombinant adiponectin were assessed.
Methods  The recombinant plasmid pMD18-T-hADPN and eukaryotic expression vector pcDNA3.1+ were digested by two restrictive endonucleases and adiponectin and linear pcDNA3.1+ were obtained. Then, they were ligated and translated into JM109.  The recombinant pcDNA3.1+-hADPN so obtained was identified by digestion by restrictive endonuclease and nucleotide sequencing. The 3T3-L1 precursor cells were transfected using SuperFect Transfection Reagent (Qiagen). Furthermore, 3T3-L1 cells with human recombinant adiponectin incubated with dexamethasone (0.5 mmol/L) for 24 hours, cells were collected and total RNA was extracted. The PPAR-γ mRNA expression was quantified by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR).
Results  After eukaryotic recombinant was digested by Hind III and EcoR I, fragments of 800 bp and 5.4 kb were identified by nucleotide sequence scanning and consistent with theoretical values. Electrophoretogram of RT-PCR in 3T3-L1 precursors showed only one band in front of 250 bp, which was consistent with theoretical value 234 bp. In the 3T3-L1 cells, 3T3-L1 cells with plasmid and 3T3-L1 cells human recombinant adiponectin, treatment with dexamethasone (0.5 mmol/L) decreased PPAR-γ mRNA expression compared to untreated controls (P<0.01). Effect of dexamethasone on PPAR-γ mRNA expression in 3T3-L1 cells was reversed by stably transfected human recombinant adiponectin.
Conclusion  The 3T3-L1 cells stably transfected human recombinant adiponectin had increased PPAR-γ mRNA expression. Dexamethasone suppressed PPAR-γ mRNA expression in the 3T3-L1 cells. Effect of dexamethasone on PPAR-γ mRNA expression in 3T3-L1 cells was reversed by stably transfected human recombinant adiponectin.


 2007;120(2):155-158
·LogIn/LogOut
·Fulltext PDF(226K) Free
·Abstract download
TXT | XML
·Articles in CMJ by
SHE Qi-mei
ZHAO Jing
·Articles in PubMed by
SHE QM
ZHAO J
·Put into my bookshelf
·Email to Friend
·Email to author
·Visit:5399
·Download:2985
·Advanced Search
·Related Articles
·Change font size: Small font Middle font Big font
·Cannot read some characters

Adipose tissue, especially visceral fat, expresses numerous genes encoding secretory proteins (leptin, tumour necrosis factor-α, plasminogen activator inhibitor-1, adipsin, adiponectin).1 Adiponectin (ADPN) is an adipose tissue specific, plasma glycoprotein with various homologies to collagen, complement proteins and hibernation associated proteins. The human adiponectin (also called apM1 or GBP-28) gene and its mouse homologue (adipoQ or ACRP30) have been identified. This protein is only expressed and secreted by adipocytes and adipose tissue.2-5 Adiponectin is a member of the soluble defense collagen superfamily and plasma adiponectin concentrations and mRNA expression have been shown to be decreased in murine and human obesity and insulin resistance.2,6,7 A study8 revealed that adiponectin was not simply a factor passively regulated by insulin resistance and obesity, but actively influenced these states: a proteolytic cleavage product of adiponectin increased fatty acid oxidation in muscle and caused weight loss in mice. Consistent with an insulin sensitizing effect, transgenic ablation of adiponectin in mice induces insulin resistance9,10 whereas transgenic overexpression improves insulin sensitivity.11,12

Impairment of peroxisome proliferator activated receptor-gamma (PPAR-γ), a nuclear receptor that regulates genes involved in lipid and glucose metabolism, may contribute to the onset of metabolic disorders such as diabetes and the accompanying dyslipidaemia. Glucocorticoids are known to induce insulin resistance, reportedly by affecting insulin binding, insulin receptor substrate-1 phosphorylation, and glucose transporter translocation.13-15

METHODS

Materials
QIAquick Gel Extraction Kit, QIAprep Spin Miniprep kit, SuperFect transfection reagent, and RNeasy Mini kit were obtained from Qiagen (Germany). Restriction enzyme EcoR I, Hind III, DNA Marker DL2000, RNA inhibitor, AMV reverse transcriptase XL, and Taq enzyme were obtained from TaKaRa (Japan). Insulin, dexamethasone, methyl-isobutyl-xanthine (MIX), Dulbecco's Modified Eagle Medium (DMEM), and G418 were obtained from Sigma Chemical (USA).

Cell lines
The 3T3-L1 cell line was a kind gift from Zhongshan Medical University (China), and pMD18-T/hADPN were constructed by Anatomy Department Laboratory of Peking University Health Science Centre.

Construction of the eukaryotic recombinant with complete adiponectin cDNA
The recombinant plasmid pMD18-T-hADPN and eukaryotic expression vector pcDNA3.1+ were digested by two restrictive endonucleases. The adiponectin and linear pcDNA3.1+ obtained were linked and translated into JM109. The recombinant pcDNA3.1+-hADPN obtained was identified by digestion by restrictive endonuclease and nucleotide sequencing.

Cell culture and cell transfection
3T3-L1 precursor cells were maintained at 37˚C in an atmosphere of 5% CO2 and DMEM supplemented with 10% fetal bovine serum (FBS) (v/v), 2 mmol/L glutamine and required antibiotics. 3T3-L1 precursor cells were plated at a concentration of 1×106 cells/well in six-well plates at one day before transfection. The adiponectin eukaryotic recombinant was transfected with SuperFect transfection reagents and selected in the presence of 600 mg/L G418. The positive cells were selected and cloned.

Identification of cell transfection
Total RNA was isolated using RNeasy Mini kit from 3T3-L1 precursor cells according to the manufacturer's instructions. Adiponectin mRNA gene expression was measured by reverse transcription-polymerase chain reaction (RT-PCR). For RT-PCR analysis, 2 µg of total RNA was reverse transcribed using standard reagents and 50% of each reverse transcription reaction was amplified in a 50 µl polymerase chain reaction. Samples were incubated in the LightCycler for an initial predenaturation at 94˚C for 1 minute followed by 30 polymerase chain reaction cycles at 94˚C for 30 seconds, 58˚C for 30 seconds, and 72˚C for 1 minute. Final annealing was 72˚C for 4 minutes. The following oligonucleotide primers were used: adiponectin cDNA specific primers: upstream primer 5'-GTCCTAAGGGAGACATCGGT-3', downstream primer 5'-TGCAGTGGAATTTACCAGTGG-3', β-actin cDNA specific primers: upstream primer 5'-GCCAT- GTACGTAGCCATCCA-3', downstream primer 5'-AA- CCGCTCATTGCCGATAGT-3'.

Groups
Following transfection, 3T3-L1 cells were divided into three groups: group A: 3T3-L1 cells without transfection; group B: 3T3-L1 cells stably transfected with empty plasmid; group C: 3T3-L1 cells stably transfected with human recombinant adiponectin. For the dexamethasone phase, 3T3-L1 cells were divided into four groups: group a: undifferentiated 3T3-L1 precursor cells without dexamethasone; group b: undifferentiated 3T3-L1 precursor cells with dexamethasone (0.5 mmol/L); group c: fully differentiated 3T3-L1 adipocytes without dexamethasone; group d: fully differentiated 3T3-L1 adipocytes with dexamethasone (0.5 mmol/L).

Cell induction of differentiation
At confluence, cells were treated with 0.5 mmol/L MIX, 10 µmol/L dexamethasone and 865 nmol/L insulin for 48 hours followed by insulin alone for an additional 48 hours. To examine lipid accumulation, cells were fixed with formalin and stained with Oil Red O.

RNA extraction and semi-quantitative RT-PCR
Total RNA was isolated using RNeasy Mini kit from 3T3-L1 adipocytes according to the manufacturer's instructions. PPAR-γ mRNA gene expression was measured by RT-PCR. For RT-PCR analysis, 2 µg of total RNA was reverse transcribed using standard reagents and 50% of each reverse transcription reaction was amplified in a 50 µl polymerase chain reaction. Samples were incubated in the LightCycler for an initial predenaturation at 94˚C for 1 minute, followed by 30 polymerase chain reaction cycles. Each cycle consisted of 94˚C for 30 seconds, 58˚C for 30 seconds, 72˚C for 1 minute. Final annealing was at 72˚C for 4 minutes. The following oligonucleotide primers were used: PPAR-γ CTGGCCTCCCTGATGAATAA (sense) and GGCGG TCTCCACTGAGAATA (antisense); β-actin GCCATGTA CGTAGCCATCCA (sense) and AACCGCTCATTG CCGATAGT (antisense). After electrophoresis of polymerase chain reaction products, the data was analysed by Image Master Tatal Laboratory ID software. The quantity of PPAR-γ mRNA gene expression in 3T3-L1 adipocytes was calculated by the ratio of light density of PPAR-γ mRNA and β-actin.

Statistical analysis
For analysis of differences between groups or between subgroups, a two factor design was used. P values < 0.05 are considered statistically significant.

RESULTS

The recombinant pcDNA3.1+-hADPN was obtained and identified
The adiponectin eukaryotic recombinant pcDNA3.1+- hADPN was constructed. The adiponectin eukaryotic recombinant pcDNA3.1+-hADPN was identified by the nucleotide sequence scanning. Fragments of 800 bp and 5.4 kb were consistent with theoretical values after eukaryotic recombinant was digested by Hind III and EcoR I (Fig. 1).
 

view in a new window

Fig. 1. Plasmid pcDNA3.1+ and recombinant plasmid pcDNA3.1+-hADPN by digestion with restriction enzymes. Lane 1: Marker; Lane 2: recombinant plasmid pcDNA3.1+-hADPN by digestion with Hind III and EcoR I; Lane 3: recombinant plasmid pcDNA3.1+-hADPN by digestion with Hind III; Lane 4: plasmid pcDNA3.1+ by digestion with Hind III; Lane 5: plasmid pcDNA3.1+.


RNA extraction and semi-quantitative RT-PCR
Total RNA was isolated using RNeasy Mini kit from 3T3-L1 adipocytes according to the manufacturer's instructions. The quality of the total RNA was analyzed by electrophoresis in agarose gel. Specific primers were designed from the published human adiponectin gene sequence; the adiponectin cDNA was synthesized by a reverse transcription by using the total RNA as a template, then complete adiponectin was synthesized by polymerase chain reaction with the cDNA as a template. Polymerase chain reaction product showed only one band in front of 250 bp, which was consistent with theoretical value 234 bp (Fig. 2).
 

view in a new window

Fig. 2. Electrophoretogram of total RNA of 3T3-L1 cell and RT-PCR in 3T3-L1 precursor cells. Lane 1: DNA DL2000 Marker; Lane 2: electrophoretogram of RT-PCR in 3T3-L1 precursor cells with adiponectin eukaryotic recombinant; Lane 3: electrophoretogram of RT-PCR in 3T3-L1 precursor cells with plasmids; Lane 4: electrophoretogram of RT-PCR in 3T3-L1 precursor cells.

 
Effect of dexamethasone on PPAR-γ mRNA expression in 3T3-L1 cells with human recombinant adiponectin
After the 3T3-L1 cells and 3T3-L1 cells with plasmid, and 3T3-L1 cells with human recombinant adiponectin incubated with dexamethasone (0.5 mmol/L) for 24 hours, cells were collected and total RNA was extracted. The PPAR-γ mRNA expression was quantified by semiquantitative RT-PCR (Tables 1 and 2).
 

view in a new window
Table 1. Comparison of PPAR-γ mRNA expression in 3T3-L1
 


view in a new window

Table 2. Comparison of PPAR-γ mRNA expression in 3T3-L1

 
Compared to controls (the 3T3-L1 cells and the 3T3-L1 cells with plasmid), the PPAR-γ mRNA expression of 3T3-L1 cells with human recombinant adiponectin was higher (P<0.01). In the 3T3-L1 cells and 3T3-L1 cells with plasmids and 3T3-L1 cells with human recombinant adiponectin, treatment of 3T3-L1 cells by 0.5 mmol/L dexamethasone decreased PPAR-γ mRNA expression compared to untreated controls (P<0.05).

DISCUSSION

The secretion of adiponectin from white adipose tissue has been intensively studied in recent years. Adiponectin has emerged most recently as an important adipocytokine with insulin sensitizing effects and might, therefore, represent a novel treatment target for insulin resistance and type 2 diabetes.16,17 This protein has been shown to be suppressed in states of insulin resistance and obesity,18,19 however, it is largely unknown which factors might contribute to this downregulation. Furthermore, it appears possible that various hormones promote insulin resistance via downregulation of adiponectin.

PPAR-γ plays a central role in adipocyte differentiation and lipid metabolism by adipocytes. Understanding the mechanisms by which PPAR-γ is activated may lead to effective management of common diseases including obesity and diabetes. PPAR-γ is a member of the ligand activated nuclear receptor superfamily.20 PPAR-γ binds to the retinoid X receptor (RXR) 21 and up-regulates the expression of adipocyte specific, genes to promote adipocyte differentiation.22

pcDNA3.1 is a 5.6 kb vector derived from pcDNA3.1 and designed for high level stable and transient expression in mammalian hosts. High level stable and non-replicative transient expression can be carried out in most mammalian cells. The vector contains the human cytomegalovirus immediate early promoter for high level expression in a wide range of mammalian cells. In this study, we demonstrated that the adiponectin eukaryotic recombinant pcDNA3.1+-hADPN was constructed. The 3T3-L1 precursor cells were transfected by the recombinant plasmid pcDNA3.1+-hADPN using SuperFect transfection reagent.

Glucocorticoids have been demonstrated to cause insulin resistance in vivo.23 In the present study, we showed that the 3T3-L1 cells were stably transfected human recombinant adiponectin increased PPAR-γ mRNA expression in the 3T3-L1 cells. Dexamethasone suppressed PPAR-γ mRNA expression in the 3T3-L1 cells. Effect of dexamethasone on PPAR-γ mRNA expression in 3T3-L1 cells was reversed by stably transfected human recombinant adiponectin. Dexamethasone potently inhibits adiponectin gene expression. These findings indicate that hypoadi- ponectinaemia may be one mechanism by which dexamethasone impairs insulin sensitivity. In vivo data of patients affected by Cushing's syndrome will be helpful to further define the role of adiponectin in glucocorticoid induced insulin resistance.

It seems from the results of the current study that expression of the insulin-sensitizing adipocytokine adiponectin is greatly affected by dexamethasone. These data indicate that downregulation of adiponectin is a selectively regulated mechanism that might constitute an important step in the pathogenesis of insulin resistance and the insulin resistance syndrome.

REFERENCES

1. Fried SK, Russel CD. Diverse roles of adipose tissue in the regulation of systemic metabolism and energy balance. In: Bray GA, Bouchard C, eds. Handbook of Obesity. New York: Marcel Dekker; 1998: 397-413.

2. Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipocyte-specific gene dysregulated in obesity. J Biol Chem 1996; 271: 10697-10703.[PubMed]

3. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF. A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 1995; 270: 26746-26749.[PubMed]

4. Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, Matsubara K. cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1. Biochem Biophys Res Commun 1996; 221: 286-289. [PubMed]

5. Nakano Y, Tobe T, Choi-Miura NH, Mazda T, Tomita M. Isolation and characterization of GBP-28, a novel gelatin-binding protein purified from human plasma. J Biochem 1996; 120: 803-812.[PubMed]

6. Weyer C, Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Richard E, et al. Hypoadiponectinemia in obesity and type 2 diabetes: Close association with insulin resistance and hyperinsulinemia. J Clin Endocrinol Metab 2001; 86: 1930-1935.[PubMed]

7. Hotta K, Funahashi T, Arita Y, Takahashi M, Matsuda M, Okamoto Y, et al. Plasma concentrations of a novel, adipose–specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol 2000; 20: 1595-1599.[PubMed]

8. Fruebis J, Taso TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, et al. Proteolytic cleavage product of 30 kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci USA 2001; 98: 2005-2010.[PubMed]

9. Kubota N, Terauchi Y, Yamauchi T, Kubota T, Moroi M, Matsui J, et al. Disruption of adiponectin causes insulin resistance and neointimal formation. J Biol Chem 2002; 277: 25863-25866. [PubMed]

10. Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani H, et al. Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med 2002; 8: 731-737. [PubMed]

11. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, et al. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med 2002; 8: 1288-1295.[PubMed]

12. Yamauchi T, Kamon J, Waki H, Imai Y, Shimozawa N, Hioki K, et al. Globular adiponectin protected ob/ob mice from diabetes and apoE deficient mice from atherosclerosis. J Biol Chem 2003; 278: 2461-2468. [PubMed]

13. Saad MJ, Folli F, Kahn CR. Insulin and dexamethasone regulate insulin receptors, insulin receptor substrate-1 and phosphatidylinositol 3-kinase in Fao hepatoma cells. Endocrinology 1995; 136: 1579-1588.[PubMed]

14. Giorgino F, Almahfouz A, Goodyear LJ, Smith RJ. Glucocorticoid regulation of insulin receptor and substrate IRS-1 tyrosine phosphorylation in rat skeletal muscle in vivo. J Clin Invest 1993; 91: 2020-2030.[PubMed]

15. Sakoda H, Ogihara T, Anai M, Funaki M, Inukai K, Katagiri H, et al. Dexamethasone-induced insulin resistance in 3T3-L1 adipocytes is due to inhibition of glucose transport rather than insulin signal transduction. Diabetes 2000; 49: 1700-1708.[PubMed]

16. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, et al. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 2001; 7: 941-946.[PubMed]

17. Berg AH, Combs TP, Du XL, Brownlee M, Scherer PE. The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med 2001; 7: 947-953.[PubMed]

18. Weyer C, Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley RE, et al. Hypoadiponectinemia in obesity and type 2 diabetes: Close association with insulin resistance and hyperinsulinemia. J Clin Endocrinol Metab 2001; 86: 1930-1935.[PubMed]

19. Hotta K, Funahashi T, Arita Y, Takahashi M, Matsuda M, Okamoto Y, et al. Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol 2000; 20: 1595-1599.[PubMed]

20. Rosen ED, Spiegelman BM. PPARgamma: a nuclear regulator of metabolism, differentiation, and cell growth. J Biol Chem 2001; 276: 37731-37734. [PubMed]

21. Tontonoz P, Graves RA, Budavari AI, Erdjument-Bromage H, Lui M, Hu E, et al. Adipocyte-specific transcription factor ARF6 is a heterodimeric complex of two nuclear hormone receptors, PPAR7 and RXRa. Nucleic Acids Res 1994; 22: 5628-5634.[PubMed]

22. Tontonoz P, Hu E, Spiegelman BM. Stimulation of adipogenesis in fibroblasts by PPARγ2, a lipid-activated transcription factor. Cell 1994; 79: 1147-1156.[PubMed]

23. Andrews RC, Walker BR. Glucocorticoids and insulin resistance: Old hormones, new targets. Clin Sci 1999; 96: 513-523.[PubMed]

  Rapid Response | more responses(0)
Name Emailanonymous | Login
· Reversing effect of exogenous WWOX gene expression on malignant phenotype of primary cultured lung carcinoma cells
· Transplantation of VEGF165-gene-transfected endothelial progenitor cells in the treatment of chronic venous thrombosis in rats
· High sensitive C-reactive protein, adiponectin, and urine albumin excretion rate in Chinese coronary artery disease patients with different glucose tolerance status
· Variations of tumor necrosis factor-α, leptin and adiponectin in mid-trimester of gestational diabetes mellitus
· Effect of continuous positive airway pressure treatment on serum adiponectin level and mean arterial pressure in male patients with obstructive sleep apnea syndrome
· Effect of vascular endothelial growth factor 165 gene transfection on bone defects and its mRNA expression in rabbits
· Protective effect of O6-methylguanine-DNA-methyltransferase on mammalian cells
· Heat shock protein 70 gene transfection protects rat myocardium cell against anoxia-reoxygeneration injury
· Vascular endothelial growth factor gene transfection to enhance the repair of avascular necrosis of the femoral head of rabbit
· Transfection of B7- 1 cDNA empowers antigen presentation of blood malignant ce lls for activation of anti- tumor T cells
 

©2005-2008 Chinese Medical Journal, All Rights Reserved. ICP:05052599

Chinese Medical Assoication  Open Access  Creative Commons   Free Charge  第二届国家期刊奖百种重点期刊  中国期刊方阵双高期刊  国家自然科学基金重点学术期刊专项基金